Contrary to what the librarian says to you when you are part of loud conversation, SSSH! time here is referring to the Self-Selecting Safe Harbor (SSSH) tool invented by Zach Stevenson and crew in the Patrick Phillips Lab at the U of Oregon.
There is a back story here. We are proud of our people at InVivo Biosystems (IVB). Some, like me, have been hanging around with IVB for quite a long time. Others, like Zach, come and go, but still leave their mark.
Zachary joined us when we were pre-merger Knudra Transgencis. He was fairly new to genome engineering, but Zach was a quick study. He became a master of CRISPR-based transgenesis which he leveraged in his next career move – helping him get into graduate school at the University of Oregon. Zach and the team at Knudra had tasked themselves with the aim of finding better tools for detecting genome integration. We needed efficient systems that help identify only the animals that have experienced genomic integration. Better yet, the tool would be most effective if only the desired genome integrated strains could survive after exposure to a toxic compound. During Zach’s time at Kundra, the idea floated around a bit, but it never got the legs of experiment implementation to demonstrate its feasibility.
Once in graduate school Zach teamed up with Megan J. Moerdyk-Schauwecker and Brennen Jamison in the Phillips Lab to get the real world evidence that demonstrated the idea can work. Their team chose the hygR gene, to determine if a split-hygR gene could be harvested as tool to identify integration in a safe harbor locus (Stevenson et al. G3. 2020)
The principle is simple – chop the hygR gene into two parts. Put the long part into the genome of C. elegans and put the other part in your transgene plasmid. Zach did this at the MosSCI ttTi5605 safe harbor locus. This transgenic target strain contains most of the hygR gene but is missing a critical segment needed for creation of a functional hygromycin B phosphotransferase. Next, their transgene of interest was made in a plasmid that also contains the missing hygR part. The trick now is to have the same sgRNA site in the plasmid and in the edited safe harbor site. The interaction of the plasmid and the genome when injected with CRISPR reagents renders a region of overlap of about 700 bp on each end of the insertion cargo that allows homology repair to do its magic. When designed right, you only need one sgRNA to initiate the DNA cuts that trigger efficient homologous recombination repair. This technique works great in C. elegans transgenesis. Add hygromycin B to the growth plates and only the genomic-integrated animals can survive. Whether it can work in embryo injections with other organisms remains to determined.
At IVB we are building on this to use our fast and easy CRISPR-sdm technique to place a small the small split-hygR fragment at any locus of the genome. This will allow us to drive large constructs 5 to 10 KB (and perhaps even 20-100 KB) into any native locus.
Bottom line: Getting some SSSH! time with this split-hygR technique can calm the frustration of the aggravated C. elegans researcher.
Five months into the COVID-19 pandemic, the world is at 29,119,433 confirmed cases of SARS-Cov2 infection, including 925,965 deaths (6 August 2020 https://covid19.who.int/), which is over 3% of the planet’s human population. Of all the persons infected with the virus, 3.2% have died. If COVID-19 pandemic follows the trajectory of the 1918 influenza, 1/3rd of the world population will become infected [1], and nearly 300 million deaths will occur in the next few years. To put it in perspective, that is more than twice the number of military and civilian casualties of World Wars I and II combined. The medical community is challenged in optimizing their response due to a highly diverse array of infection severity in the human population. Some individuals are asymptomatic but test positive for SARS-CoV-2 infection, while other exposed individuals experience severe, sometimes fatal COVID-19 infection [2–4]. Disease severity heterogeneity is in part due to patients with underlying health conditions or comorbidities such as hypertension and diabetes which we believe share a common pathophysiology of renin-angiotensin system (RAS) [5]. Estimates for the number of people with an underlying condition for increased severity risk of COVID-19 are 1.7 billion persons (22%) [6]. As a result, there is an urgent need to understand the common molecular and cellular pathophysiologic basis of patients with a diversity of comorbidities and identify those with a rare disease that are at high risk for clinical deterioration. Therefore a rare human disease may be the perfect physiologic model to better understand the disease and generate more individualized therapeutic medical responses and positive outcomes for higher risk COVID-19 groups.
Some Rare Disease groups may be hyper susceptible to COVID-19 infection
There is emerging evidence that RD patients have higher COVID-19 infection risk among all human populations. For example, patients with deficiencies in cellular chloride transport due to CFTR variants associated with Cystic Fibrosis (CF) are more prone to viral and bacterial infection [7]. Yet, because COVID-19 is a newly emergent disease, clear correlation of outcomes in SARS-CoV-2 infection in CF are extremely limited in infected CF patients [8,9] but the concern remains high for these patient groups [10]. Another RD group that is likely to be negatively influenced by SARS-CoV-2 infection, are patents with CADASIL. CADASIL (Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy) is caused by genetic lesions in the extracellular domain in NOTCH3 [11]. Like CF, CADASIL appears to be linked to accelerated disease progression via Influenza virus infection [12]. Yet the co-morbidity of SARS-CoV-2 infection with NOTCH3 pathogenic variations is only speculated to be associated with advancing CADASIL presentation [13]. Clear evidence is needed in order for a pathological association between COVID-19 infection and CADASIL is supported or refuted. With this knowledge, appropriate therapeutic medical responses can be identified.
The Renin-Angiotensin System (RAS) is at the center for controlling severity of COVID-19 infection.
SARS-CoV-2 utilizes binding of ACE2 to gain entry into host tissues [14]. The resulting internalization and attenuation of ACE2 enzymatic activity is potentially a significant contributor to COVID-19 disease severity. ACE2 is a critical negative regulator of angiotensin activity. Overactive RAS signaling is implicated in higher risk for cardiovascular [15], renal [16,17], and neurodegenerative [18] disease and diabetes [19]. Angiotensin I (Ang I) signaling peptide is produced from the angiotensinogen precursor by the proteolytic activity of renin. In the canonical RAS signaling pathway, Ang I is catalyzed into Ang II by the ACE dipeptidase. Ang II peptide can bind two GPCR receptors AT1R and AT2R with opposing effects. Ang II, a high affinity agonist of the AT1R receptor, promotes inflammation, apoptosis and vasoconstriction, which often results in hypertension of the patient. The agonist activity of Ang II at AT2R receptors has an opposite effect of being anti-inflammatory, anti-apoptotic and vasodilating, which are activities that lead to lower blood pressure. The expression levels of these receptors will have profound influence on hypertension in tissues as well as the presence of Ang II metabolites. Ang II is catalyzed into Ang III by an amino peptidase that remove the N terminal asparagine and results in a molecule with increased affinity for the AT2R receptor and thus activates anti-hypertensive activity [20]. Additional control of the hypertensive state is achieved via the ACE2 dipeptidase which catalyzes Ang I into Ang 1-9 and Ang II into Ang 1-7. Ang 1-9 acts as agonists of the AT2R receptor. Similar to the anti-hypertensive activity of Ang 1-9, the Ang 1-7 peptide also promotes hypotension but through agonist activity on a different GPCR, the MasR receptor [21].
Small Vessel Disease (SVD) is a major health issue.
SVD, defined as “perforating arteries, arterioles, capillaries, and venules” is currently associated with 20% of stroke and 40% of dementia [22]. ACE polymorphisms have been associated with stroke-associated white matter hyperintensities [23] and ischemic stroke [24]. CADASIL is one of the most common single-gene disorders causing cerebral SVD [25]. Hypertension is a risk factor for SVD [26] and leads to vascular remodeling [27]. Since Ang II leads to vascular remodeling via VSMC dedifferentiation [28,29], it becomes plausible that CADASIL variants in NOTCH3 participate in generalizable VSMC remodeling of SVD via altered RAS signaling activity which may predispose these patients to a hypersensitivity to COVID-19 infection. Yet direct evidence is lacking that CADASIL-associated NOTCH3 variants have altered RAS signaling activity that leads to higher viral infectivity and/or RAS stress response.
(adapted from U.S. National Library of Medicine)
The zebrafish animal model is well suited to modeling CVD and CADASIL.
The zebrafish model organism is one of the fastest growing animal models. Walcot and Peterson have proposed zebrafish are a good model for cardiovascular disease due to “its morphological and physiological similarity to human cerebral vasculature, its ability to be genetically manipulated, and its fecundity allowing for large-scale, phenotype-based screens” [30]. For instance a Tg(flk1:GFP) reporter can be expressed in blood vessels and be visualized by fluorescence microscopy. Although iPSCs allow for a more native context, the ability of zebrafish to reproducibly make microvascular structures make them highly attractive for SVD modeling. Further, expertise and skill in gene editing is allowing the rapid creation of gene knock-outs and knock-ins throughout the zebrafish genome. We now have the ability to humanize either by putting in patient gene variations at the zebrafish version of the gene. Or, swapping out the entire gene for the human gene coding sequence. The end result is a well controlled system for examining effects of clinical variants on gene function.
CRISPR Engineering can be used to install variants into zebrafish
The creation of precision gene edits in zebrafish allows accurate measurement of the functional consequence of a clinical variant. The use of CRISPR (clustered-regularly-interspaced-short-palindromic-repeats) guide RNA targets cas9 nuclease to a specific genomic locus and has become a common method for targeting DNA cleavage at a genomic locus near a clinical variant target site. The CRISPR method has become quite routine for genomic locus disruption through Non-Homologous-End-Joining (NHEJ) activity, which creates gene-disrupting indels at a cleaved locus [31,32]. More challenging to achieve is the use of Homology-Directed-Repair to create precision genome editing at a target locus [33]. Often a donor-homology DNA is used to instruct the cell’s natural DNA repair mechanisms to insert a specific sequence of DNA at the cleaved locus. Some groups have developed ways to use donor homology sequences to guide precision insertion of content into the genome of iPSCs and create precision deletions [34] or precision insertion of reporter genes [35,36]. Yet, interference from NHEJ-mediated indels in attempts at precision editing can pose a problem when the researcher desires to isolate a line with only precision edits. Often biallelic editing occurs in an HDR attempt that results in a complex heterozygote. One allele may report to edit as desired, but often the other sister chromatid locus has an undesirable indel. Development of methods that suppress indel formation by avoiding NHEJ activity can be useful in the creation of a biallelic conversion that creates the desired HDR-mediated edit in both chromatid loci.
A zebrafish model system for assessing COVID-19 viral uptake sensitivity is set up by first humanizing appropriate genes (NOTCH3) and then installing CADASIL-associated variants.
Humanization increases the data relevance of animal models. In this project idea, we can create a humanized zebrafish expressing the hNOTCH3 coding sequence inserted in the first exon of the zebrafish notch3 gene. In a two step procedure, we first use HDR-directed CRISPR gene editing to insert a phiC31 transposase acceptor sequence (attB sequence: CGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCAC) to disrupt the notch3 locus with early stop codon insertion. Next we rescue the null with phiC31 insertion of hNOTCH3 expression cassette, which is a proven method for inserting large cargo at site specific loci in zebrafish. The cassette cargo contains a self cleaving T2A peptide prior to the human hNOTCH3 coding sequence. This enables expression of the human transgene to be driven by the promoter elements of the zebrafish notch3 gene and yet avoid chimeric protein formation with the vestigial notch3 coding fragment. To create a clinical variant model, the same plasmid used for human hNOTCH3 insertion is modified to contain a clinical variant (C174Y). Heterozygotic animals are expected to be generated (trangene/+). Both the attB containing animal (“knock-out”) and the hNOTCH3(C174Y) are expected to not isolate as homozygous due to essential nature of NOTCH3, while the hNOTCH3(wt) is hoped to remain viable as homozygote. Once these goals and expectations are met, the animals can be used to explore CADASIL associated pathologies. For instance, viral particles expressing the S-peptide receptor binding domain can be exposed to normal and variant zebrafish to monitor for different rates of viral entry.
The uses of a humanized zebrafish model range from diagnostic to drug discovery applications.
Researchers at various institutions can use the animals to determine which human pathologies are conserved. For mechanism-directed drug development, researchers can use in silico methods to discover small molecules that can be screened for specifically restoring the cysteine balance and promoting normal gene function. For pathway-directed drug development, researchers can use the animals for RNA-seq experiment to discover biomarkers consistent with disease and then harvest these genes with high expression response to create fluorescent reporters of pathogenic activity. The end result of this project funding is a platform for rapid assessment and drug discovery in CADASIL-associated disease.
1918 Pandemic (H1N1 virus). 16 Jun 2020 [cited 28 Aug 2020]. Available: https://www.cdc.gov/flu/pandemic-resources/1918-pandemic-h1n1.html
Paces J, Strizova Z, Smrz D, Cerny J. COVID-19 and the immune system. Physiol Res. 2020;69: 379–388.
Gao Z, Xu Y, Sun C, Wang X, Guo Y, Qiu S, et al. A Systematic Review of Asymptomatic Infections with COVID-19. J Microbiol Immunol Infect. 2020. doi:10.1016/j.jmii.2020.05.001
CDC COVID-19 Response Team. Preliminary Estimates of the Prevalence of Selected Underlying Health Conditions Among Patients with Coronavirus Disease 2019 – United States, February 12-March 28, 2020. MMWR Morb Mortal Wkly Rep. 2020;69: 382–386.
Onweni CL, Zhang YS, Caulfield T, Hopkins CE, Fairweather DL, Freeman WD. ACEI/ARB therapy in COVID-19: the double-edged sword of ACE2 and SARS-CoV-2 viral docking. Crit Care. 2020;24: 475.
Clark A, Jit M, Warren-Gash C, Guthrie B, Wang HHX, Mercer SW, et al. Global, regional, and national estimates of the population at increased risk of severe COVID-19 due to underlying health conditions in 2020: a modelling study. Lancet Glob Health. 2020;8: e1003–e1017.
Bucher J, Boelle P-Y, Hubert D, Lebourgeois M, Stremler N, Durieu I, et al. Lessons from a French collaborative case-control study in cystic fibrosis patients during the 2009 A/H1N1 influenza pandemy. BMC Infect Dis. 2016;16: 55.
Colombo C, Burgel P-R, Gartner S, van Koningsbruggen-Rietschel S, Naehrlich L, Sermet-Gaudelus I, et al. Impact of COVID-19 on people with cystic fibrosis. Lancet Respir Med. 2020;8: e35–e36.
Cosgriff R, Ahern S, Bell SC, Brownlee K, Burgel P-R, Byrnes C, et al. A multinational report to characterise SARS-CoV-2 infection in people with cystic fibrosis. J Cyst Fibros. 2020;19: 355–358.
Manti S, Parisi GF, Papale M, Mulè E, Aloisio D, Rotolo N, et al. Cystic Fibrosis: Fighting Together Against Coronavirus Infection. Front Med. 2020;7: 307.
Wang MM. CADASIL. Handb Clin Neurol. 2018;148: 733–743.
Mizutani K, Sakurai K, Mizuta I, Mizuno T, Yuasa H. Multiple Border-Zone Infarcts Triggered by Influenza A Virus Infection in a Patient With Cerebral Autosomal Dominant Arteriopathy Presenting With Subcortical Infarcts and Leukoencephalopathy. Journal of Stroke and Cerebrovascular Diseases. 2020. p. 104701. doi:10.1016/j.jstrokecerebrovasdis.2020.104701
Williams OH, Mohideen S, Sen A, Martinovic O, Hart J, Brex PA, et al. Multiple internal border zone infarcts in a patient with COVID-19 and CADASIL. Journal of the Neurological Sciences. 2020. p. 116980. doi:10.1016/j.jns.2020.116980
Zhang H, Penninger JM, Li Y, Zhong N, Slutsky AS. Angiotensin-converting enzyme 2 (ACE2) as a SARS-CoV-2 receptor: molecular mechanisms and potential therapeutic target. Intensive Care Med. 2020;46: 586–590.
Paz Ocaranza M, Riquelme JA, García L, Jalil JE, Chiong M, Santos RAS, et al. Counter-regulatory renin-angiotensin system in cardiovascular disease. Nat Rev Cardiol. 2020;17: 116–129.
Ichihara A, Kobori H, Nishiyama A, Navar LG. Renal renin-angiotensin system. Contrib Nephrol. 2004;143: 117–130.
Nishiyama A, Kobori H. Independent regulation of renin-angiotensin-aldosterone system in the kidney. Clin Exp Nephrol. 2018;22: 1231–1239.
Almeida-Santos AF, Kangussu LM, Campagnole-Santos MJ. The Renin-Angiotensin System and the Neurodegenerative Diseases: A Brief Review. Protein Pept Lett. 2017;24: 841–853.
Henriksen EJ, Prasannarong M. The role of the renin-angiotensin system in the development of insulin resistance in skeletal muscle. Mol Cell Endocrinol. 2013;378: 15–22.
Bouley R, Pérodin J, Plante H, Rihakova L, Bernier SG, Maletínská L, et al. N- and C-terminal structure-activity study of angiotensin II on the angiotensin AT2 receptor. Eur J Pharmacol. 1998;343: 323–331.
Cha SA, Park BM, Kim SH. Angiotensin-(1-9) ameliorates pulmonary arterial hypertension angiotensin type II receptor. Korean J Physiol Pharmacol. 2018;22: 447–456.
Coupland K, Lendahl U, Karlström H. Role of NOTCH3 Mutations in the Cerebral Small Vessel Disease Cerebral Autosomal Dominant Arteriopathy With Subcortical Infarcts and Leukoencephalopathy. Stroke. 2018;49: 2793–2800.
Paternoster L, Chen W, Sudlow CLM. Genetic determinants of white matter hyperintensities on brain scans: a systematic assessment of 19 candidate gene polymorphisms in 46 studies in 19,000 subjects. Stroke. 2009;40: 2020–2026.
Zhang Z, Xu G, Liu D, Fan X, Zhu W, Liu X. Angiotensin-converting enzyme insertion/deletion polymorphism contributes to ischemic stroke risk: a meta-analysis of 50 case-control studies. PLoS One. 2012;7: e46495.
Choi JC. Genetics of cerebral small vessel disease. J Stroke Cerebrovasc Dis. 2015;17: 7–16.
Cuadrado-Godia E, Dwivedi P, Sharma S, Ois Santiago A, Roquer Gonzalez J, Balcells M, et al. Cerebral Small Vessel Disease: A Review Focusing on Pathophysiology, Biomarkers, and Machine Learning Strategies. J Stroke Cerebrovasc Dis. 2018;20: 302–320.
Renna NF, de Las Heras N, Miatello RM. Pathophysiology of vascular remodeling in hypertension. Int J Hypertens. 2013;2013: 808353.
Xu H, Du S, Fang B, Li C, Jia X, Zheng S, et al. VSMC-specific EP4 deletion exacerbates angiotensin II-induced aortic dissection by increasing vascular inflammation and blood pressure. Proc Natl Acad Sci U S A. 2019;116: 8457–8462.
Mondaca-Ruff D, Riquelme JA, Quiroga C, Norambuena-Soto I, Sanhueza-Olivares F, Villar-Fincheira P, et al. Angiotensin II-Regulated Autophagy Is Required for Vascular Smooth Muscle Cell Hypertrophy. Front Pharmacol. 2018;9: 1553.
Deneault E, White SH, Rodrigues DC, Ross PJ, Faheem M, Zaslavsky K, et al. Complete Disruption of Autism-Susceptibility Genes by Gene Editing Predominantly Reduces Functional Connectivity of Isogenic Human Neurons. Stem Cell Reports. 2018;11: 1211–1225.
Soldner F, Laganière J, Cheng AW, Hockemeyer D, Gao Q, Alagappan R, et al. Generation of isogenic pluripotent stem cells differing exclusively at two early onset Parkinson point mutations. Cell. 2011;146: 318–331.
Deneault E, Faheem M, White SH, Rodrigues DC, Sun S, Wei W, et al. or human iPSC-derived neurons from individuals with autism develop hyperactive neuronal networks. Elife. 2019;8. doi:10.7554/eLife.40092
Like many responsible citizens of the USA, I am hunkered down in self quarantine. Trying to come to grips with new uncertainty in the world and how it will have impact on my life. I find myself wanting to help. To do what I can to help stop this beast we call COVID19. But How?
Collective Behavior Modification is Part of the Answer.
What we are dealing with here mutually is a form of trauma. We are experiencing the Kuber-Ross grief cycle. Each of us are oscillating somewhere along its spectrum.
image credit: adapted from psycom.net/depression.central.grief
Many of us are stuck in denial. Although as of late, I seem to be bouncing from anger to bargaining to depression and back again (note, this entire piece for the blog is an elaborate form of bargaining!!!)
I want to get to acceptance and start doing constructive things.
Shedding the denial by attempting to understand the size of the problem.
If you somehow have been in a timewarp, or you have been tunneling under a rock for the past few months, COVID19 is a raging pandemic that is threatening to kill our parents/grandparents. And it is causing major economic crises throughout the world. Some of our leadership say this will pass in just a few weeks from now, but when you dive into the data, that suggestion is just plain ludicrous fantasy. It will take many months of concerted efforts by everyone to tackle the COVID19 problem. If we choose to ignore what we need to do, the ramifications are immense.
Some are calling it a war, so lets look at it from that lens.
The civil war was an extremely traumatic event for my home country of the USA. We are still dealing with its baggage to this day and its death toll was immense. World War II was a big effort, industries stopped what they were doing and channeled vast resources to the war effort. Many a dad and mum did not come home, but the concentrated effort of its population probably helped reduce loss of life. When we look at the loss of life from World War II we have a significant 290 deaths per 100,000. Everyone knew someone who did not come home. Yet, that death rate pales in comparison to what unmitigated COVID19 could do to us in the coming months if unchecked. More than twice as many dead if we do nothing.
Is All This Stuff Real? – Yes, ….This is Getting Real, …Real Quick
A recent article by a very respected group of researchers paints an alarming picture. Ferguson et al released a study March 16 that describes 3 scenarios each with different consequence on the health system measured in critical care beds occupied per 100,000 population.
image credit: adapted from Ferguson et al.
Scenario 1. Do Nothing.
In this scenario (black line) we get the 2.2 million dead in the USA. The surge capacity of hospital beds is overwhelmed 25x. Many die that could have been saved, if we had the resources.
Scenario 2. Mitigation (“soft”)
In the mitigation scenario we have multiple options. We can close schools and universities. This surprisingly does not have much effect (green line). The algorithm takes into account “Household contact rates for student families increase by 50% during closure. Contacts in the community increase by 25% during closure” which offsets gains of social distancing achieved with school closure. Case isolation by itself has a stronger effect (orange line). For Case Isolation, symptomatic cases are asked to stay home for 7 days. This reduces “non household contacts by 75% for this period. Household contacts remain unchanged. Assumes 70% of households comply with the policy.” Add to Case Isolation a Home Quarantine where family sequesters for 14 days (assume 50% comply), and we get a boost that has more than halved the lethality rate. Finally add in social distancing in the greater than 70 year olds, where this group sequesters themselves away from close contact by avoiding crowd gatherings, maintaining 6 feet distance from strangers, avoiding restaurants and the like, and we get additional decrease in hospitalization (blue line). Yet even this multi-step mitigation effort is not enough. It is too soft to have the needed impact. Even with the multiple mitigation measures in place, the capacity of the health care system is still overwhelmed by more than 8x. More severe and hard measures are needed.
Scenario 3 Suppression (“hard”)
In mitigation, we are creating a decrease in the transmission number (R0 = R “naught”), which is the average number of persons infected by a person who is actively shedding the COVID19 virus. The do nothing R0 number is 2.4. This means an infectious person spreads COVID19 to an average of 2.4 persons. Mitigation decreases the R0 number, but does not drive it down to 1 or below. To get R0 below 1 where the infected are infecting less than one person, bigger steps need to be taken by the entire population. To implement effective suppression, we do the Case Isolation, as seen in mitigation, but now we add in General Social Distancing. We ask everyone to avoid getting together in groups exceeding 10 persons. Each of us should maintain 6 foot distance when talking to others. We should capture a sneeze or cough in the elbow or a tissue, and wash hands way more frequently than usual. Further, we should avoid touching our hands to face as much as possible. It is expected that “all households reduce contact outside the household, school or workplace by 75%. School contact rates are unchanged, workplace contact rates reduced by 25%. Household contact rates are assumed to increase by 25%.” Yet this his is still not enough to get to R0 down to 1, so we explore two more steps as options.
image credit: adapted from Ferguson et al.
Option 1. (Case Isolation and General Social Distancing) + Household Quarantine
Option 2. (Case Isolation and General Social Distancing) + School and University Closure
We can see that adding in Household Quarantine, during the 5 months that suppression measures are in place, gets us just to the hospital bed surge capacity (red line). Yet in contrast, School and University Closure has an even more pronounced effect. During the 5 month period, we are well below the stress capacity of the medical services. We will know the success of our suppression approaches when there is no capacity problem being detected.
Herd Immunity – Resisting the Urge to Celebrate Too Soon.
Unfortunately, when the suppression measures are lifted, the COVID19 is due to come roaring back this fall. The advantage of option 1 (Household Quarantine) is it allows for better development of Herd Immunity. From wikipedia we have the definition of Herd Immunity as occurring “when a large percentage of a population has become immune to an infection, whether through previous infections or vaccination, thereby providing a measure of protection for individuals who are not immune” With an R0 of 2.4 for COVID19, roughly half of a population needs to be exposed, either by recovering from infection or use of effective vaccine, and R0 is driven down to 1 or less.
Pharmaceutical Interventions – what can we do?
Chloroquine. Currently there are no approved treatments as a vaccine or drug therapy against COVID19. Yet, if we had them in place, we might be able to more quickly get control of this infectious disease and be spared the estimated 12 to 18 months of various mitigation and suppression techniques – approaches that slowly build herd immunity at the least amount of deaths. Scientists and the pharmaceutical industry are rallying quickly get pharmaceutical interventions in place. And they have made some interesting findings. Hydroxychloroquine, less toxic than Chloroquine, has undergone a small clinical trial on COVID19 patients with very encouraging results. Gautret et al observed a dramatic 2-3 fold faster clearance of SARS-CoV-2 (the “official name” of the COVID19 virus) relative to untreated controls. The results became even more dramatic for another small group of patients that received both hydroxychloroquine and azithromycin – complete clearance in all patients was observed at day 4 of the 6 day observation window. Yet the numbers tested are tiny. So repeating this in larger populations will tell us if they are onto something. Nevertheless, it is a promising start. The current hypothesis is that this antimalarial drug blocs viral envelope fusion by altering the pH of the endosome and thereby slowing down the activity of the acid proteases present (cathepsins or possibly TMPRSS2). Yet it is important to consult a doctor first, because self medication has resulted in unnecessary death.
image credit: adapted from PLoS Pathog, 10 (11), e1004502 2014
The action of chloroquine may be multimodal. In 2005, it was demonstrated chloroquine in a SARS-CoV infection of a cell line caused incomplete glycosylation of ACE2 and that it can have “an antiviral effect during pre- and post-infection conditions suggest that it is likely to have both prophylactic and therapeutic advantages.”
Camostat mesilate. In a drug targeting approach, Hoffmann et al monitored the classic endosomal-lysosomal entry for coronaviruses with an endosomal fusion assay. They found entry into the cytoplasm to be mediated by the activity of TMPRSS2 and cathepsin proteases. First, these authors made a comparison between SARS-CoV (the coronavirus causing the pandemic of 2012) and the SARS-CoV-2 (the coronavirus causing the current COVID19 pandemic) and found S protein In COVID19 is more prone to cleavage at the S1/S2 site. Next, they looked at inhibitors of cathepsin (E-64d) and TMPRSS2 (camostat) and found that, depending on cell type, inhibition by either protease could interfere with early fusion. When they looked at a lung cell line (Calu-3), they found that camostat could strongly inhibit early fusion. The site of cleavage for TMPRSS2 protease is the same site for furin and loss of this ability to cleave S-protein is critical for viral entry into the cell. Further Camostat is nearly established for efficacy and safety in humans for treating pancreatitis. In summary, these researchers found “SARS-CoV-2 can use TMPRSS2 for S protein priming and camostat mesylate, an inhibitor of TMPRSS2, blocks SARS-CoV-2 infection of lung cells.” So we have two very good candidate molecules for use in suppressing COVID19.
image credit: adapted from Hoffmann 2020
Smoking Gun – But Where is the Expression?
Although camostat can have a dramatic impact on early fusion and it appears to be acting on TMPRSS2 serine protease, what has puzzled me is the tissue specificity. If the primary mode of infection is the lung, then it stands to reason that lung tissue should have high expression of the protease. Yet when one looks at the tissue-specific expression profiles on the Human Protein Atlas (HPA), the expression of TMPRSS2 is absent in the lung.
TMPRSS2 is related to TMPRSS11D 55% sequence similarity and 40% identity). The Pharos Drug Database indicates the TMPRSS11D gene may also be involved in coronavirus fusion in the cell. Like TMPRSS2, the Pharos database indicates TMPRSS11D protease “plays a role in the proteolytic processing of ACE2.” Intriguingly, the TMPRSS11D gene has a signature for expression for being in lung tissue via Human Protein Atlas (HPA) (dark green bar). Further, examining ligands for these two genes via the Pharos Drug Database indicates both proteins share two ligands (compound 5 and its derivative CHEMBL1809251). Since these shared molecules have similar binding affinities between the proteins, it may be the topography of their active sites is similar. Although they both can cleave ACE2, it remains to be shown if they also have similar activities on the S protein. Yet if true, then we have two enzymatic targets for therapeutic development.
ACE2 expression also puzzled me. Its protein expression overview in Human Protein Atlas (HPA) shows no lung expression but expression in the gut is off-the-charts. Auguring in on two papers indicates that its expression does occur in the lung, but only in a small subset of lung cells . These references indicate many other tissues have high expression of of ACE2 (gut and throat). Further examination of tissue localization for SARS-CoV-2 indicates the following tissues exhibit high infection. We have our expected lung (alveolar epithelial cells) but we also have gut (mucosal enterocytes of the intestine, stomach, trachea/bronchus, distal convoluted renal tubule, sweat gland, parathyroid, pituitary, pancreas, adrenal gland, liver and cerebrum) and many of these tissues also express ACE2.
Using Molecular Dynamics Modeling to Dock Candidate Compounds
image credit: adapted from PyMOL rendering
If an enzyme has a good crystal structure, one can do simulated docking of compounds to come up with categories of interacting molecules that can be used as hits for exploring their capacity to block viral entry into target cells. Regrettably crystal structures are lacking for both TMPRSS2 and TMPRSS11D. Not true for ACE2 gene, since the finding of its association to SARS in 2003, multiple crystal structures are available (6LZG, 6M0J, 6M17, 6VW1). In one recent structure, we can see the binding interface between CoV-2 and ACE2. One approach might be to design an interference molecule that “cloaks” the ACE2 molecule. Ideally, it would interfere with S protein binding but not block normal enzymatic activity.
image credit: adapted from PyMOL rendering
Another possible target for drug development is the main protease (“Mpro”). The main protease (also called “3CLpro”) is a protease that helps process the long protein polymer made from the viral genome into functional fragments. The main protease as been derived for its structure at the molecular level. A peptidomimetic α-ketoamides as broad-spectrum inhibitors has been designed and if safety profiling indicates it has low toxicity against human proteases, screening other drug candidates for interaction could prove to be therapeutically useful.
Time is of the essence – the evolving landscape
Finding new therapeutic approaches quickly is important because as COVID19 spreads, the virus is able to explore diversity through mutation. Increasing levels of heterogeneity can be expect for a single stranded RNA virus – errors in the genome during the viral replication cycle will accumulate. A recent study was made available on the web that looks at genetic diversity among COVID19 strains. Especially disconcerting is that as the virus spreads, different strains are arising with different mutational lineages. Mutations in the S-peptide binding to ACE2 or in the S1/S2 cleavage site could render a new lineage that is more virulent. This is important because the binding affinity (Kd) of SARS-CoV-2 is nearly 5x more than Sars-CoV.
image credit: nextstrain.org/ncov
Fight Viral Diversity with Human Diversity
The natural diversity of human populations might offer some defense against viral evolution. The Gnomad database is a good resource for examining the diversity in humans. If we look at the binding interface between S-peptide and human ACE2, we cans see if there are humans with variations at the binding interface which may disrupt COVID19 infections. There are multiple EM structures to reference for examining the binding interface (6LZG, 6M0J, 6M17, 6VW1). Using the 6M17 structure, Yan et al showed the binding interface is in close proximity to many residues in ACE2 (Gln24, Asp30, His34, Tyr41, Gln42, Met82, Lys353, and Arg357).
image credit: Yan et al. Science 04 Mar 2020:
Many gene variants seen in human populations exist at this binding interface. One intriguing residue is Lys26Arg. This genetic variation exist in 600 for every 100,000 persons. Although the change may not seem to be too drastic – a positive charged amino acid is substituted with a similarly charged amino acid. Yet we know that it is arginine, and according to a prior blog post, the arginine amino acid hold special privilege for its involvement in population variation analysis.
We can float two hypothesis regarding this Lys26Arg variant
Hypothesis A – Resistance: Persons with the Lys26Arg human variant might have an ACE2 protein with disrupted interaction to the S-protein spike. The S-protein becomes highly compromised for tricking this ACE2 protein into helping it get inside the cell.
Hypothesis B – Sensitivity: Persons with the Lys26Arg human variant might have an ACE2 protein exhibiting stronger interaction to the S-protein spike. The S-protein can use this ACE2 protein to get inside the cell more efficiently.
The Problem of Heterogeneity
We are diploid organisms which means we have two copies for every gene. In regards to hypothesis A, this mean most of the persons carrying the Lys26Arg have only one copy. The other copy is the common natural variant (“wildtype”). Because they harbor a wild type variant, these persons at best would about 50% less susceptible. Thus hypothesis A for COVID19 resistance would be a subtle effect. If on the other hand, the variant had 10x has more binding to S-protein, then persons carrying this variant could be more susceptible at greater than 2 fold effect. Systems that could measure these binding effects in diploid animal formats would be elucidating for which hypothesis dominates for a given variant.
In summary, there are promising targets for developing therapeutics and vaccines. One target is the interaction of SARS-CoV-2 with ACE2. Another target is the activity of the human proteases (TMPRSS2, cathepsins and possibly TMPRSS11D) that process and cleave the S2 fragment of the spike (S-protein) allowing it to have easier access into the cell. And finally, the third target is the main protease, the enzyme that processes the polypeptide made from the mRNA transcript of the COVID19 genome.
